View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_29 (Length: 236)
Name: NF8102_low_29
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 41777799 - 41777564
Alignment:
| Q |
1 |
catttttggatgttagatagagcatcaatgcattaataatgtgattgattttctgagacttaatagtgaaaacaagtttatggtatctagatttcctctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41777799 |
catttttggatgttagatagagcatcaatgcattaataatgtgattgattttctgagacttaatagtgacaacaagtttatggtatctagatttcctctg |
41777700 |
T |
 |
| Q |
101 |
ctttaaacgatctcattaactactttagtttaaaactcctaaggctgcatatcagaaatttgacctgtttttgtgttaaactcgccttatattttcattc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777699 |
ctctaaacgatctcattaactactttagtttaaaactcctaaggctgcatatcagaaatttgacctgtttttgtgttaaactcgccttatattttcattc |
41777600 |
T |
 |
| Q |
201 |
atgtcattttgatgctcacatcttccacctcttgct |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41777599 |
atgtcattttgttgctcacatcttccacctcttgct |
41777564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University