View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_30 (Length: 230)
Name: NF8102_low_30
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 30966987 - 30966786
Alignment:
| Q |
19 |
agttctttgtttttctattcagtatgtttgtatgtttgtaaactgattttgtgtatcatgaagttcagtttagggaagtgtttcttgagcattagttagt |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30966987 |
agttctttgtctttctattcagtatgtttgtatgtttgtaaactgattttgtgtatcatgaagttcagtttagggaagtgtttcttgagtattagttagt |
30966888 |
T |
 |
| Q |
119 |
ttcttttggttgcttagct---------------tattgtgtatctcaggttgctatataaagcagtcttgtatcaaactcaattcagttaatgataata |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30966887 |
ttcttttggttgcttagctgtcaagtaactcggctattgtgtatctcaggttactatataaagcagtcttgtatcaaactcaattcagttaatgagaata |
30966788 |
T |
 |
| Q |
204 |
ca |
205 |
Q |
| |
|
|| |
|
|
| T |
30966787 |
ca |
30966786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 182
Target Start/End: Original strand, 30288291 - 30288331
Alignment:
| Q |
142 |
gtgtatctcaggttgctatataaagcagtcttgtatcaaac |
182 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
30288291 |
gtgtatctcagtttgctatatatagcagtcttgtaccaaac |
30288331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University