View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_33 (Length: 217)
Name: NF8102_low_33
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 39378545 - 39378731
Alignment:
| Q |
13 |
gagaagaaccttgaggattagaagaaggagaagaaggaatagaacaaggatttttcattggttcaccacatagatcactattaccagaaaacacttttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378545 |
gagaagaaccttgaggattagaagaaggagaagaaggaatagaacaaggatttttcattggttcaccacatagatcactattaccagaaaacacttttgt |
39378644 |
T |
|
| Q |
113 |
ttcctggttcaacaaaacaggggactctggtatttcaccagtgagattgttgaatgatagatcaacggttgcgttactcggaatttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39378645 |
ttcctggttcaacaaaacaggggactccggtatttcgccagtgagattgttgaatgatagatcaacggttgcgttactgggaatttt |
39378731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University