View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_high_12 (Length: 252)
Name: NF8103_high_12
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 26683663 - 26683908
Alignment:
| Q |
1 |
tgttagcctatataaaaggtttgatttgaacacttgtaatcaattctctcatattaatactatttatattttcctaatacctgcatcagaagaagatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26683663 |
tgttagcctatataaaaggtttgatgtgaacacttgtaatcacttctctcatattaatactatttatattttcctaatacctgcatcagaagaagatcca |
26683762 |
T |
 |
| Q |
101 |
acatagttacaaacttgctgagattgagacgtgcggcgcctttgaatgctcttcagtaagtgcttcttacctttctgaaaaccttcattaaaaaactccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26683763 |
acatagttacaaacttgctgagattgagacgtgcggcgcctttgaatgctcttcagtaagtgcttcttacctttctgaaaaccttcattaaaaaactccc |
26683862 |
T |
 |
| Q |
201 |
atttgtcggtgtcaatcttgcggaatccctgtcctcaaacaccaaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26683863 |
atttgtcggtgtcaatcttgcggaatccctgtgctcaaacaccaaa |
26683908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University