View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8103_high_14 (Length: 250)

Name: NF8103_high_14
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8103_high_14
NF8103_high_14
[»] chr7 (1 HSPs)
chr7 (1-238)||(29048650-29048887)
[»] chr8 (1 HSPs)
chr8 (32-220)||(11703618-11703809)


Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 29048650 - 29048887
Alignment:
1 agttcgcgagtcgaatccatatcgatgtttttcttgatggtggataccatgtgttagatgaatcaacttattatagcagtgatcttaggcctacttcaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29048650 agttcgcgagtcgaatccatatcgatgtttttcttgatggtggataccatgtgttagatgaatcaacttattatagcagtgatcttaggcctacttcaag 29048749  T
101 acaactatggaagaaagcaattggtgtattggaacttggcattttgaatgctgatgtacaaccaaccaaaactagggatggtagaggggcagcagatgta 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29048750 acaactatggaaaaaagcaattggtgtattggaacttggcattttgaatgctgatgtacaaccaaccaaaactagggatggtagaggggcagcagatgta 29048849  T
201 tactgtgtggcaaaatatggtcacaaatgggtgcgaac 238  Q
    ||||||||||||||||||||||||||||||||||||||    
29048850 tactgtgtggcaaaatatggtcacaaatgggtgcgaac 29048887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 220
Target Start/End: Complemental strand, 11703809 - 11703618
Alignment:
32 tcttgatggtggataccatgtgttagatgaatcaacttattatagcagtgatcttaggcctacttcaagacaactatggaagaaagcaattggtgtattg 131  Q
    |||||||||||| |||||||| || || || ||||||||| |||| |||||||| || || || ||||| || || ||||||||  | ||||| || ||     
11703809 tcttgatggtgggtaccatgttttcgacgagtcaacttatcatagtagtgatctcagaccgacatcaaggcagctgtggaagaagccgattggcgtctta 11703710  T
132 gaacttggcattttgaatgctgatg---tacaaccaaccaaaactagggatggtagaggggcagcagatgtatactgtgtggcaaaatatgg 220  Q
    |||||||||||| | |||| |||||   | || || |  ||| | |||||||| |||||  || |||||| |||||||||||||||||||||    
11703709 gaacttggcattctaaatgttgatggacttcatcctatgaaagccagggatggaagaggaacatcagatgcatactgtgtggcaaaatatgg 11703618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University