View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_high_17 (Length: 246)
Name: NF8103_high_17
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_high_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 246
Target Start/End: Complemental strand, 29644139 - 29643917
Alignment:
| Q |
24 |
tttctgattttagaattgaagaagtaatgaggattaactctacataagctaaaaacactttaccgacgtgcaataagctattttaatgtttttccaaata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29644139 |
tttctgattttagaattgaagaagtaatgaggataaactctacataagctaaaaacactttaccgacgtgcaataagctattttcatgtttttccaaata |
29644040 |
T |
 |
| Q |
124 |
ctgtgctatgcaaaacttgtttccacatgcattgaatcaaattatactatgatgtcactttgttttgttagtttctaaaacatctccgcaaatatctaca |
223 |
Q |
| |
|
| ||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29644039 |
cggtgttatgcaaaacttgtttccacatgcatacaatcaaattacactatgatgtcactttgttttgttagtttctaaaacatctccgcaaatatctaca |
29643940 |
T |
 |
| Q |
224 |
tgggaagatttgattgaatgcat |
246 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29643939 |
tgggaagatttgattgaatgcat |
29643917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University