View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_low_14 (Length: 318)
Name: NF8103_low_14
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 283
Target Start/End: Original strand, 27682772 - 27683026
Alignment:
| Q |
17 |
atatacactctttttcgaacactattctaaacactactatgttatttgataaaatttatataagtctcacattttataaattgatcccacataaaatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27682772 |
atatacactctttttcgaacactattctaaacaccactatgttatttgataaaatttatataagtctcacactttataaattgatcccacataaaatatt |
27682871 |
T |
|
| Q |
117 |
tagattcagatgagtaataagataatgattgttagaaagtgtgatagaaataaaaattgcatatctcatatttaaaatataaaccgtcccactttgaccc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27682872 |
tagattcagatgagtaataagataatgattgt------------tagaaataaaaattgcatatctcatatttaaaatataaaccgtcccactttgaccc |
27682959 |
T |
|
| Q |
217 |
acagcttataaatcgtcacataatttaacataagttttataactttacgtattatatatgtttacat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27682960 |
acagcttataaatcgtcacataatttaacataagttttataactttacgtattatatatgtttacat |
27683026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University