View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_low_16 (Length: 311)
Name: NF8103_low_16
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_low_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 3350453 - 3350704
Alignment:
| Q |
16 |
cactaacgatggtaaaggtctacgtttgcactattttgaaaatatccttattagatgcaactaaatcatccttattaatctgtgtagtaacttttgcaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3350453 |
cactaacgatggtaaaggtctacgtttgcactattttgaaaatatccttattagatgcaactaaatcatcattattaatctgtgtagtaacttttgcaca |
3350552 |
T |
 |
| Q |
116 |
tcacttcaaaaaagaaatttgcacatataatgagtaaataatttagtatctaataatgtataggagtatatccagagttatcatattatcaataactcaa |
215 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3350553 |
ttacttcaaaaaagaaatttgcacatataatgagtaaataatttagtatctaataatgtataggagtatatccagagttatcatattatcaataactcaa |
3350652 |
T |
 |
| Q |
216 |
cttgatccaatccaacagtgattcaataagatgacgtaagtttcttctcact |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3350653 |
cttgatccaatccaacagtgattcaataagatgacgtaagtttcttctcact |
3350704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 57
Target Start/End: Original strand, 3350408 - 3350437
Alignment:
| Q |
28 |
taaaggtctacgtttgcactattttgaaaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3350408 |
taaaggtctacgtttgcactattttgaaaa |
3350437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 311
Target Start/End: Original strand, 32870731 - 32870775
Alignment:
| Q |
267 |
tcgaccaacgatgagcacggttatgtgaagaatttgttttatcgt |
311 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32870731 |
tcgaccaaagatgagccaggtaatgtgaagaatttgttttatcgt |
32870775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University