View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_low_18 (Length: 274)
Name: NF8103_low_18
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 824347 - 824104
Alignment:
| Q |
17 |
acaaaacacttgttgcaactggttttttggtgggaacaaaagagagaatgcggcagaggatatcgtcaggtaaactgctgatagtatccatctgcgctgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
824347 |
acaaaacacttgttgcaactggttttttggtgggaacaaaagagagaatgtggcagaggatatcgtcaggtaaattgctgatagtatccatctgcgctgc |
824248 |
T |
|
| Q |
117 |
tgctgctgttggttagggttttgcttttggtagtgcattggttaggggtttacgtgaataaaatcatgtttataattcgttttttcaataaataaacccc |
216 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
824247 |
tactgctgttggttagggttttgtttttggtagtgcattggttaggggtttacgtgaataaaatcatgtttataattcgttttttcaataaataaacccc |
824148 |
T |
|
| Q |
217 |
attctaaaagaaccatgataaactcatatgttaaaactgatgtc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
824147 |
attctaaaagaaccatgataaactcatatgttaaaacttatgtc |
824104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 990908 - 990989
Alignment:
| Q |
17 |
acaaaacacttgttgcaactggttttttggtgggaacaaaagagagaatgcggcagaggatatcgtcaggtaaactgctgat |
98 |
Q |
| |
|
||||||| ||||| ||||||| || ||| |||| ||||| |||||||||||| | ||||| ||||| || ||||||||||| |
|
|
| T |
990908 |
acaaaacgcttgtagcaactgcttcttttgtggatacaaatgagagaatgcggaaaaggatttcgtcgggcaaactgctgat |
990989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University