View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_low_27 (Length: 246)
Name: NF8103_low_27
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_low_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 24 - 246
Target Start/End: Original strand, 29048184 - 29048406
Alignment:
| Q |
24 |
tggcattccgattcaatgtctcctaatgaaagcttttcagctaactatgctcagattcggtctaaagtctacacttctccaaggttatggtacctacgtg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048184 |
tggcattccgattcaatgtctcctaatgaaagcttttcagctaactatgctcagattcggtctaaagtctacacttctccaaggttatggtacctacgtg |
29048283 |
T |
 |
| Q |
124 |
tgaaagtgattgaggcacacgacttggtttcacacgacaacaagtctagagctcctgatgcttttgttaaggtgcaacatggtaaccagattttcaagac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048284 |
tgaaagtgattgaggcacacgacttggtttcacacgacaacaagtctagagctcctgatgcttttgttaaggtgcaacatggtaaccagattttcaagac |
29048383 |
T |
 |
| Q |
224 |
aaaaccggttcaatcaagaatca |
246 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29048384 |
aaaaccggttcaatcaagaatca |
29048406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 11704147 - 11704086
Alignment:
| Q |
180 |
gatgcttttgttaaggtgcaacatggtaaccagattttcaagacaaaaccggttcaatcaag |
241 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
11704147 |
gatgcttatgttaaggtgcagactggtaaccagattttgaagacaaaacccgttcaatcaag |
11704086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University