View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_low_29 (Length: 230)
Name: NF8103_low_29
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_low_29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 53617263 - 53617475
Alignment:
| Q |
18 |
catcatttggtgtatattgttggttggtcgatttttcataaggtgaagcttgttagagaaccaacaaagcctttacctaatggcgggaatttgaatttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617263 |
catcatttggtgtatattgttggttggtcgatttttcataaggtgaagcttgttagagaaccaacaaagcctttacctaatggcgggaatttgaatttgg |
53617362 |
T |
|
| Q |
118 |
gggaaatactcaagtacaagtcacaagaaggtgtaagagttttactcttggtttgggatgataaaacttcacacagcaaatttttcatttacacgggaag |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
53617363 |
gggaattactcaagtacaagtcacaagaaggtttaagagttttactcttggtttgggatgataaaacttcacacagcaaatttttcattaacacggtaag |
53617462 |
T |
|
| Q |
218 |
atattattgatta |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53617463 |
atattattgatta |
53617475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 79
Target Start/End: Original strand, 9151894 - 9151934
Alignment:
| Q |
39 |
ggttggtcgatttttcataaggtgaagcttgttagagaacc |
79 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
9151894 |
ggttggtcgatttatgataaggtgaagcttgttagggaacc |
9151934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University