View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8103_low_5 (Length: 416)
Name: NF8103_low_5
Description: NF8103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8103_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 185 - 402
Target Start/End: Original strand, 9192787 - 9193010
Alignment:
| Q |
185 |
ttttttcttacttaaagctcaatatttcaaacaaactcaacaaggaatggttaatctctattttgtatgaattagctattgagatattggcttggttcac |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9192787 |
ttttttcttacttaaagctcaatatttcaaacaaactcaacaaggaatggttaatctctattttgtatgaattagctattgagatattggcttggttcac |
9192886 |
T |
 |
| Q |
285 |
tcagaagaaacaaaaaataacactacttgtgaatg------ttttgattttgattttgattgagccgtgccaatatttcaaatgctatttcatgttttca |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9192887 |
tcagaagaaacaaaaaataacactacttgtgaatgttttgattttgattttgattttgattgagccgtgccaatatttcaaatgctatttcatgttttca |
9192986 |
T |
 |
| Q |
379 |
ttcataggttatagtgtgatgaat |
402 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9192987 |
ttcataggttatagtgtgatgaat |
9193010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 9192615 - 9192718
Alignment:
| Q |
1 |
ggagctaatactatggattttaatgctctgtcccttctttatgccttggtagtcgagtgttttaaatgctatatacaggccctctctctttttaaaccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9192615 |
ggagctaatactatggattttaatgctctgtcccttctttatgccttggtagtcgagtgttttaaatgctatatacaggccctctctctttttaaaccta |
9192714 |
T |
 |
| Q |
101 |
agaa |
104 |
Q |
| |
|
|||| |
|
|
| T |
9192715 |
agaa |
9192718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University