View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8105_low_6 (Length: 240)
Name: NF8105_low_6
Description: NF8105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8105_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 17 - 107
Target Start/End: Original strand, 41130852 - 41130942
Alignment:
| Q |
17 |
gaaagatggaacgtaccgttttgaaggaagagactataatagtaattatgatttggagacgatatcaaagaggaggtaaactaggttagca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130852 |
gaaagatggaacgtaccgttttgaaggaagagactataatagtaattatgatttggagacgatatcaaagaggaggtaaactaggttagca |
41130942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 178 - 233
Target Start/End: Original strand, 41131013 - 41131068
Alignment:
| Q |
178 |
ttgtgagaattattgcaaagggagagcctataattaacaccactagcatctctgct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41131013 |
ttgtgagaattattgcaaagggagagcctataattaacaccactagcatctttgct |
41131068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University