View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8105_low_7 (Length: 237)
Name: NF8105_low_7
Description: NF8105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8105_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 21 - 218
Target Start/End: Complemental strand, 30309716 - 30309515
Alignment:
| Q |
21 |
acgcccgcgcagttcacctgtccaggtttgtctcctccttcttctccgttttctctggattacaaagcttaaatgcattttcttagaatgaaatttgatt |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30309716 |
acgcccacgcagttcacctgtccaggtttgtctcctccttcttctctgttttctctggattacaaagcttaaatgcattttcttagaatgaaatttgatt |
30309617 |
T |
|
| Q |
121 |
tgttttta----attattaataatctattaacttaatggatgcattttcaatttctgtttaaactaaagttcggtgtgttgcagaatgggaaagggtttg |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30309616 |
tgtttttaattaattattaataatctattaacttaatggatgcattttcaatttctgtttaaactaaagttcggtgtgttgcagaatgggaaagggtttg |
30309517 |
T |
|
| Q |
217 |
at |
218 |
Q |
| |
|
|| |
|
|
| T |
30309516 |
at |
30309515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University