View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_high_16 (Length: 260)
Name: NF8106_high_16
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 32870586 - 32870815
Alignment:
| Q |
16 |
catcacaggctaggccttttttcaagaggggtttaaaagaaaataagcatctggttgattcaaggcttaaggt---atttgaccgtaatgagatgactcg |
112 |
Q |
| |
|
|||||||||||||||||||||||| | | | |||||||| ||| || ||||||||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
32870586 |
catcacaggctaggccttttttcatgcgtgctttaaaaggaaaaaatgatctggttgatccaaggcttaagaagcaatttgaccgtaaagagatgactca |
32870685 |
T |
 |
| Q |
113 |
tatgatagcatgcgctgaagcttgcacgcgtctgtcagcaaatgatcgaccaacgatgagcacggtaatgtgaagaatttgttttatcgtttaccctacc |
212 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| ||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32870686 |
tatggtagcatgcgctgcagcttgcacgcgtcagtcagcaaaggatcgaccaaagatgagccaggtaatgtgaagaatttgttttatcgtttaccctacc |
32870785 |
T |
 |
| Q |
213 |
tgtttattttcaactgacattcttcttttc |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
32870786 |
tgtttattttcaactgtcattcttcttttc |
32870815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 90 - 207
Target Start/End: Original strand, 32903929 - 32904046
Alignment:
| Q |
90 |
tttgaccgtaatgagatgactcgtatgatagcatgcgctgaagcttgcacgcgtctgtcagcaaatgatcgaccaacgatgagcacggtaatgtgaagaa |
189 |
Q |
| |
|
||||||| ||||||||||||||||||| | |||||||||| ||||||||| |||| |||||||| |||||||| ||||||| ||||| ||||||| |
|
|
| T |
32903929 |
tttgaccctaatgagatgactcgtatggtggcatgcgctgcagcttgcacacgtcactcagcaaagcgtcgaccaaagatgagccaggtaaagtgaagag |
32904028 |
T |
 |
| Q |
190 |
tttgttttatcgtttacc |
207 |
Q |
| |
|
|||||| |||| |||||| |
|
|
| T |
32904029 |
tttgttatatcatttacc |
32904046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University