View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8106_high_27 (Length: 225)

Name: NF8106_high_27
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8106_high_27
NF8106_high_27
[»] chr5 (1 HSPs)
chr5 (16-214)||(22836802-22837000)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 22837000 - 22836802
Alignment:
16 aaaggaacagaagtcttagtgaagttaagttggagagatttggaatgggaccgttgaaacggttgcgtttaaggctgagtacacggagctgagtaagtgc 115  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22837000 aaaggaacaaaagtcttagtgaagttaagttggagagatttggaatgggaccgttgaaacggttgcgtttaaggctgagtacacggagctgagtaagtgc 22836901  T
116 ggttaacggttccatcgagccgtggaggtcgaggttttcgaggactaggcgggagacacggttcctaagacaagagacaccgtaccatgtgcacaggtt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||||    
22836900 ggttaacggttccatcgagccgtggaggtcgaggttttcgaggacaaggcgggagacacggtttcttagacaagagacaccgtaccatgtgcataggtt 22836802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University