View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_low_13 (Length: 298)
Name: NF8106_low_13
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 278
Target Start/End: Original strand, 35657019 - 35657286
Alignment:
| Q |
5 |
aatgtgatagactgtctaatctagatcgaacgacctcaaatatcccaagtttgcgtggaatattattgaatgtacgtgagtcggtgagtcggtccattgt |
104 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35657019 |
aatgtgatagaccgtataatctagatcgaacgacctcagatatcccaagtttgcgtgaaatattattgaatgtacgtga--------gtcggtccattgt |
35657110 |
T |
 |
| Q |
105 |
ttttatccaatgtagcttacaccatatccaactattttgttgctgcacagcattagcatagcgcatgagaaaacctgaacag--aatagttcatgcggaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35657111 |
ttttatccaatgtagcttacaccatatccaactattttgttgctgcacagcattagcatagcgcatgagaaaacctgaacagtaaatagttcatgcggaa |
35657210 |
T |
 |
| Q |
203 |
tcattatcttcatcgctctctctttcttcgatccccaaattctgcgaactgcgaaccctaatttcacatttcttcg |
278 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35657211 |
tcatcatcttcatcactctctctttcttcgatccccaaattctgcgaactgcgaaccctaatttcacatttcttcg |
35657286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University