View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_low_14 (Length: 285)
Name: NF8106_low_14
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 36057987 - 36058247
Alignment:
| Q |
18 |
agacaagtgcacaatcaaatctcccggatgctataacttcaatgcctcgagagttgacacaagattagacatttccatgatatagacccttatcttccct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36057987 |
agacaagtgcacaatcaaatctcccggatgctataacttcaatgcctcgagagttgacacaagattagacatttccatgatatagacccttatcttccct |
36058086 |
T |
|
| Q |
118 |
ttcccttaat-------------gaacatcaacaaagcactagttgtcttgtctcaaccttatcatttttggtaaataaatctctctatagtttcaagga |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36058087 |
ttcccttaataattcattgaaatgaacatcaacaaagcactagttgtcttgtctcaaccttatcatttttggtaaataaatctctctatagtttcaagga |
36058186 |
T |
|
| Q |
205 |
acttcttagcactttcattcttagtaatccatcccataatcacttcaagtataagtatgta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36058187 |
acttcttagcactttcattcttagtaatccatcccataatcacttcaagtataagtatgta |
36058247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University