View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_low_17 (Length: 276)
Name: NF8106_low_17
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 10 - 260
Target Start/End: Original strand, 15177271 - 15177521
Alignment:
| Q |
10 |
agaagaatgtctaagacccatttgcgcacttaagcataggacctaacatgtgaaggttgaaggattcttgaagtgaggttgcgtcttaagaggcgccaaa |
109 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| |||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177271 |
agaagaatgtctaacacccatttgcgcgcttgagcataggacttaacctgtgaagggtgaaggattcttgaagtgaggttgcgtcttaagaggcgccaaa |
15177370 |
T |
|
| Q |
110 |
tgggaccgtagaagctaaagaggatgttgtgttgattgcggctaattatattctttgttggaacggccttagggcaatcagcgaagatggtgctattttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||| ||||| |||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
15177371 |
tgggaccgtagaagctaaagaggatgtcatgttgattgctgctaattatcttctttgtgggaaccgcctcagggcgatcagcgaatatggtgctattttg |
15177470 |
T |
|
| Q |
210 |
gattaatgcttgatgtgcaagaaatctgttggcaattaaaatgtccgtgtt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
15177471 |
gattaatgcttgatgtgcaagaaatctattggcaatgtaaatgtcggtgtt |
15177521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University