View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_low_23 (Length: 251)
Name: NF8106_low_23
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 54882646 - 54882421
Alignment:
| Q |
10 |
gagatgaaaattcagaataagttaaacgagtcatgtttagtttctttgtagtctctcattttatttttatttcagtcttgttgaattaaaatgccttaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54882646 |
gagatgaaaattcagaataagttaaacgagtcatgtttagtttctttgtagtctctcattttatttttatttcagtcttgttgaattaaaatgccttaca |
54882547 |
T |
 |
| Q |
110 |
atgttatatttatctttatcaagataataatatacaccaccatacactacagccatagtatcattaaacaatccacgcgcnnnnnnngtttgtactctaa |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54882546 |
atgttatatttatctttatctagataataatatacaccaccatacactacagccatagtatcattaaacaatccacgcgctttttttgtttgtactctaa |
54882447 |
T |
 |
| Q |
210 |
ctatgcaatcttaaaaaatctctata |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
54882446 |
ctatgcaatcttaaaaaatctctata |
54882421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University