View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_low_35 (Length: 223)
Name: NF8106_low_35
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 37162335 - 37162122
Alignment:
| Q |
1 |
tagttgtttggtaatagttcataaactattaaaatacatcaatatattctcaaaattactataaaacaaacaataatcgagtccttgataagagaaacaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37162335 |
tagttgtttggtaatagatcataaactattaaaatacatcaatatattctcaaaattactataaaacaaacaataatcgagtccttgataagagaaacaa |
37162236 |
T |
 |
| Q |
101 |
taattgtgtctctcaaccttagaaaactttttgttatttatcctcattctcatatttatcacgtggtattgatattcttccactcaaaaaagaagccaca |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37162235 |
taattgtgtctctcaacattagaaaactttttgttatttatcctcattctcatatttatcacgtggtagtgatattcttccactcaaaaaagaagccaca |
37162136 |
T |
 |
| Q |
201 |
ttgaaggtctattt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37162135 |
ttgaaggtctattt |
37162122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University