View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8106_low_9 (Length: 340)
Name: NF8106_low_9
Description: NF8106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8106_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 37 - 204
Target Start/End: Complemental strand, 37645496 - 37645332
Alignment:
| Q |
37 |
cagcaaatcattttaatttgcttaagaaattagagcatcggtatttcctacctaattcagtagtcatgaagagttctaattctttgaatgagcaatgttt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37645496 |
cagcaaatcattttaatttgcttaagaaattagagcatcggtatttcctacctaattcagtagtcatgaagagttctaa---tttgaatgagcaatgttt |
37645400 |
T |
 |
| Q |
137 |
catagacacacttttacccacaccccattatacaccctcatgtggcagcttatgtagcatttcaattt |
204 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37645399 |
cgaagacacacttttacccacaccttattatacacccccatgtggcagcttatgtagcatttcaattt |
37645332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University