View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8107_low_31 (Length: 268)
Name: NF8107_low_31
Description: NF8107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8107_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 48 - 227
Target Start/End: Complemental strand, 32346649 - 32346470
Alignment:
| Q |
48 |
acttttaagt-atattatggaaaattatgtatgtcatcctttaagtttaacnnnnnnnaggaaataatgtcacgaactattaaatttatagttcaaccta |
146 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
32346649 |
acttttaagttatattatggaaaattatgtatgtcatcctttaagtttaactttttc-aggaaataatgtcacgaactattaagtttatagttcaagcta |
32346551 |
T |
 |
| Q |
147 |
ctttgcaagtggagtagtttaatgacattagttatgtggagaaacatttattaccatgttttcataggttgtacgtgtgtg |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346550 |
ctttgcaagtggggtagtttaatgacattagttatgtggagaaacatttattaccatgttttcataggttgtacgtgtgtg |
32346470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University