View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8107_low_31 (Length: 268)

Name: NF8107_low_31
Description: NF8107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8107_low_31
NF8107_low_31
[»] chr2 (1 HSPs)
chr2 (48-227)||(32346470-32346649)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 48 - 227
Target Start/End: Complemental strand, 32346649 - 32346470
Alignment:
48 acttttaagt-atattatggaaaattatgtatgtcatcctttaagtttaacnnnnnnnaggaaataatgtcacgaactattaaatttatagttcaaccta 146  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||| |||||||||||| |||    
32346649 acttttaagttatattatggaaaattatgtatgtcatcctttaagtttaactttttc-aggaaataatgtcacgaactattaagtttatagttcaagcta 32346551  T
147 ctttgcaagtggagtagtttaatgacattagttatgtggagaaacatttattaccatgttttcataggttgtacgtgtgtg 227  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32346550 ctttgcaagtggggtagtttaatgacattagttatgtggagaaacatttattaccatgttttcataggttgtacgtgtgtg 32346470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University