View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8107_low_38 (Length: 227)
Name: NF8107_low_38
Description: NF8107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8107_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 49068501 - 49068288
Alignment:
| Q |
1 |
ctcttgatactgaagattatgaatcttgtgctaggtttgttcaaactttccttcagattgatgcacagtttaaggattctggttctgatcagattcagat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49068501 |
ctcttgataccgaagattatgaatcttgtgctaggtatgttcaaactttccttcatattgatgcacagtttaaggattctggttctgatcagattcagat |
49068402 |
T |
 |
| Q |
101 |
tcagagggagcgtttgttggaagtgaagaaacagcttgaaggtattctcaggaagaatctttcttccgcggtggatcagcgtgatcatcctgctattctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49068401 |
tcagagggagcgtttgttggaagtgaagaaacagcttgaaggtattgtcaggaagaagctttcttcctcggtggatcagcgtgatcatcctgctattctt |
49068302 |
T |
 |
| Q |
201 |
aggtttgttcgtct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49068301 |
aggtttgttcgtct |
49068288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 100 - 197
Target Start/End: Original strand, 26697214 - 26697311
Alignment:
| Q |
100 |
ttcagagggagcgtttgttggaagtgaagaaacagcttgaaggtattctcaggaagaatctttcttccgcggtggatcagcgtgatcatcctgctatt |
197 |
Q |
| |
|
|||||||||| |||| ||||||| |||||| | |||||||| ||| | |||||||| |||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
26697214 |
ttcagagggaatgtttactggaagtcaagaaaaatcttgaagggattgtgaggaagaagctttcttccgtggtgaatcagcgtgatcatcctgttatt |
26697311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University