View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8107_low_39 (Length: 224)
Name: NF8107_low_39
Description: NF8107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8107_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 54894084 - 54893893
Alignment:
| Q |
17 |
attcttgtttttgattgcagaaatacagacttagtctcaaacgaccgtctaaacaagctaaagtagatgctgcactagatcctctccagcaaaagggttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54894084 |
attcttgtttttgattgcagaaatacagacttagtctcaaacgaccgtctaaacaggctaaagtagatgctgcactagatcctctccagcaaaagggttc |
54893985 |
T |
|
| Q |
117 |
agtaggtggatatggagatttttgcaccttacctggatcaagaagaatcttaagtagcacactgccaacatatgcatctagtagcatgtttt |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54893984 |
agtacgtggatatggagatttttgcaccttacctggatcaagaagaatcttaagtagcacactgccaacatatgcatctagtggcatgtttt |
54893893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 30 - 208
Target Start/End: Complemental strand, 54888447 - 54888269
Alignment:
| Q |
30 |
attgcagaaatacagacttagtctcaaacgaccgtctaaacaagctaaagtagatgctgcactagatcctctccagcaaaagggttcagtaggtggatat |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| |||||||| |||| ||||||||||||| ||||||||| || |||||| |||||||| ||||||| |
|
|
| T |
54888447 |
attgcagaaatacaaacttagtctcaaaagaccatctaaacaggctagagtagatgctgcattagatcctcacctacaaaagaattcagtagctggatat |
54888348 |
T |
|
| Q |
130 |
ggagatttttgcaccttacctggatcaagaagaatcttaagtagcacactgccaacatatgcatctagtagcatgtttt |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
54888347 |
ggagatttttgtaccttacctggatcaagaagaatcttaagcagcacattgccaacatatgcatctagtaacatgtttt |
54888269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 102 - 194
Target Start/End: Complemental strand, 54904497 - 54904405
Alignment:
| Q |
102 |
ccagcaaaagggttcagtaggtggatatggagatttttgcaccttacctggatcaagaagaatcttaagtagcacactgccaacatatgcatc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||| || |||| |||| ||||||| |||||||||| |
|
|
| T |
54904497 |
ccagcaaaagggttcagtaggtggatatggggatttttgcaccttatctggatcaacaagagtcctaagcagcatactgccagcatatgcatc |
54904405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University