View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8107_low_40 (Length: 220)

Name: NF8107_low_40
Description: NF8107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8107_low_40
NF8107_low_40
[»] chr5 (2 HSPs)
chr5 (156-203)||(35163385-35163432)
chr5 (1-46)||(35163233-35163278)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 35163385 - 35163432
Alignment:
156 ctggacgccgtccacccttataaatactagacactcccaccttctttt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
35163385 ctggacgccgtccacccttataaatactagacactcccaccttctttt 35163432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 35163233 - 35163278
Alignment:
1 caaagaacaaccgccaaataattcacttaactaccggttgattgat 46  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||    
35163233 caaagaacaaccgccaaataattcacttaactaccagttgattgat 35163278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University