View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8107_low_40 (Length: 220)
Name: NF8107_low_40
Description: NF8107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8107_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 35163385 - 35163432
Alignment:
| Q |
156 |
ctggacgccgtccacccttataaatactagacactcccaccttctttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163385 |
ctggacgccgtccacccttataaatactagacactcccaccttctttt |
35163432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 35163233 - 35163278
Alignment:
| Q |
1 |
caaagaacaaccgccaaataattcacttaactaccggttgattgat |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35163233 |
caaagaacaaccgccaaataattcacttaactaccagttgattgat |
35163278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University