View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8108_high_4 (Length: 265)
Name: NF8108_high_4
Description: NF8108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8108_high_4 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 49446598 - 49446350
Alignment:
| Q |
17 |
atcagcaatttaccggagactctcatctgtcatattctctcttttctccctaccaaacaagctgttgccactagtgtccttgcaaagaggtggatacatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446598 |
atcagcaatttaccggagactctcatctgtcatattctctcttttctccctaccaaacaagctgttgccactagtgtccttgcaaagaggtggatacatc |
49446499 |
T |
|
| Q |
117 |
tatggtgctcagttctcgctatcaacttcagcaacacagagctatatcaccaagaagcctgttttcgcttcagctagtctgtgtattctgttttgctttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49446498 |
tatggtgctcagttctcgctatcaacttcagcaacacagagctatatcaccaagaagcctgttttcgcttcagcgagtctgtgtattctgttttgctttc |
49446399 |
T |
|
| Q |
217 |
acgtaattccatcaaaagtttttgccttggcattacatatggtgaggag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446398 |
acgtaattccatcaaaagtttttgccttggcattacatatggtgaggag |
49446350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 144
Target Start/End: Complemental strand, 49439080 - 49438983
Alignment:
| Q |
47 |
catattctctcttttctccctaccaaacaagctgttgccactagtgtccttgcaaagaggtggatacatctatggtgctcagttctcgctatcaactt |
144 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||||||||| ||||| | ||||| |||| |||| |||| |||||||| ||| ||||||||| |
|
|
| T |
49439080 |
catattctctcttttctcccaaccaaacaggttgttgccactagcgtcctatccaagagatggaagcatcaatggcgctcagttttcgatatcaactt |
49438983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 39 - 110
Target Start/End: Complemental strand, 49427677 - 49427606
Alignment:
| Q |
39 |
tcatctgtcatattctctcttttctccctaccaaacaagctgttgccactagtgtccttgcaaagaggtgga |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||| || |||||||||||||||||| | ||||| |||| |
|
|
| T |
49427677 |
tcatctgtcatattatctcttttctcccaaccgaacaggcggttgccactagtgtcctttcgaagagatgga |
49427606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 12539864 - 12539910
Alignment:
| Q |
41 |
atctgtcatattctctcttttctccctaccaaacaagctgttgccac |
87 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
12539864 |
atctgccacattctctcttttctccctaccaaacaatctgctgccac |
12539910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University