View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_high_18 (Length: 352)
Name: NF8109_high_18
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 17 - 341
Target Start/End: Original strand, 52763983 - 52764307
Alignment:
| Q |
17 |
aaacctaactcggttcatcctatttccagcctcaattaaattgctgtttgaagtttctaatatcacttccccgcaatttaatttactgcatttctgtgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763983 |
aaacctaactcggttcatcctatttccagcctcaattaaattgctgtttgaagtttctaatatcacttccccgcaatttaatttactgcatttctgtgtc |
52764082 |
T |
|
| Q |
117 |
agtctacatgcacaagaacgtttggctgaatttgacttgttggttctgtttggattcttcagaaactgacccaccaagtgcacaacaatccatcatccgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52764083 |
agtctacatgcacaagaacgtttggctgaatttgacttgttggttctgtttggattcttcagaaactgacccaccaagtgcacaacaatccatcatccgt |
52764182 |
T |
|
| Q |
217 |
atataactaaaattaaaattgtacccttatgataattgattagtcctgttctgcattgtgtttcattgtcatatatttacccagcattagcagtatgaca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52764183 |
atataactaaaattaaaattgtacccttatgataattgattagtcctgttctgcattgtgtttcattgtcatatatttacccagcattagcagtatgaca |
52764282 |
T |
|
| Q |
317 |
atggaaaatacaattttgaatctct |
341 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52764283 |
atggaaaatacaattttgaatctct |
52764307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University