View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_high_27 (Length: 245)
Name: NF8109_high_27
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_high_27 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 36158363 - 36158143
Alignment:
| Q |
13 |
attttaccattttctgaaattcaatttccagataggagaatatatagaggcagtgaggatcaaacttttgaccttttgatcatagatatggataataaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36158363 |
attttaccattttctgaaattcaatttccagataggagaata----gaggcagtgaggatcaaacttttgacc--------atagatatggataataaat |
36158276 |
T |
 |
| Q |
113 |
aaaatctaactgtgagaataagcttgaaagtagaatttgtttttctttatacccttatacctcccaatgccaaaagaccctgctcactctataacccctc |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36158275 |
aaaatctaacagtgagaataagcttgaaagtataatttgtttttctttatatccttatacctcccaatgccaaaagaccctgctcactctataacccctc |
36158176 |
T |
 |
| Q |
213 |
ctccctatttataggtgacgtgcttttatttat |
245 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
36158175 |
ctccctatttataggtgacatgcttttatttat |
36158143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 36153438 - 36153346
Alignment:
| Q |
1 |
tgcataaacctaattttaccattttctgaaattcaatttccagataggagaatatatagaggcagtgaggatcaaacttttgaccttttgatcataga |
98 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||| ||||||| ||||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
36153438 |
tgcataaacctaattttatcattttctgaaattcaattt-cagttaggaga----atagaggcagtaaggatcaaactttagacctcttgatcataga |
36153346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 172
Target Start/End: Complemental strand, 36153247 - 36153201
Alignment:
| Q |
126 |
gagaataagcttgaaagtagaatttgtttttctttatacccttatac |
172 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36153247 |
gagaataagcttgaaagtataatttgtctttctttatacccttatac |
36153201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University