View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_high_39 (Length: 207)
Name: NF8109_high_39
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_high_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 38419189 - 38419006
Alignment:
| Q |
1 |
cccctttcatatacacttgaacaagatttatcgctttatgatatcttcgcaatgagcaaagcttccacacaagactctcaaagcattcaatgtctggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38419189 |
cccctttcatatacacttgaacaagatttatcgctttatgatatcttcgcaatgagcaaagcttccacacaagactctcaaagcattcaatgtctggatt |
38419090 |
T |
|
| Q |
101 |
tacaccagcgtttaacatttcaaacaagaaatcatgtgcaatgtcaaccttattggacttgcagagaccaataaccatggaaca |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38419089 |
tacaccagcgtttaacatttcaaacaagaaatcatgtgcaatgtcaaccttattggacttgcagagaccaataaccatggaaca |
38419006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 9 - 167
Target Start/End: Complemental strand, 38411192 - 38411034
Alignment:
| Q |
9 |
atatacacttgaacaagatttatcgctttatgatatcttcgcaatgagcaaagcttccacacaagactctcaaagcattcaatgtctggatttacaccag |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| |||||| ||||||||||||| || ||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
38411192 |
atatacacatgaacaagatttatcgcttcatggtatctttccaatgagcaaagcgtctgcacaagaatctcaaagcattcaatgcttggatttaatccag |
38411093 |
T |
|
| Q |
109 |
cgtttaacatttcaaacaagaaatcatgtgcaatgtcaaccttattggacttgcagaga |
167 |
Q |
| |
|
| || ||||||| ||||||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
38411092 |
ctttaaacatttgaaacaagaaatcatgtgcaatgtcagccttacaggatttgcagaga |
38411034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University