View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_16 (Length: 388)
Name: NF8109_low_16
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 118 - 287
Target Start/End: Complemental strand, 5042601 - 5042432
Alignment:
| Q |
118 |
gatctttatgcgatcattatttgaccgcatggaatagaaccttataatatcacatatagtctccaaaatgtgatgtttcaatgtcagaacctattattgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5042601 |
gatctttatgcgatcattatttgaccacatggaatagaaccttataatatcacatatagtctccaaaatgtgatgtttcaatgtcaagacctattattgt |
5042502 |
T |
 |
| Q |
218 |
ggtgacacattccattgtcacaactcacaaggaaaattattgtacgactcttttttctactttgttttat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042501 |
ggtgacacattccattgtcacaactcacaaggaagattattgtacgactcttttttctactttgttttat |
5042432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 279 - 375
Target Start/End: Complemental strand, 5042247 - 5042151
Alignment:
| Q |
279 |
ttgttttattacttaccggttgagtttattatgagacaaaccaattgcagaggcagatacttattttgctatgagatcctttggtgtatatatatat |
375 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |||| | ||||||| |
|
|
| T |
5042247 |
ttgttttattacttagcggttgaatttattataagacaaaccaattgcagaggcggatacacattttgctatgagatcctttagtgtgtgtatatat |
5042151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 5042718 - 5042675
Alignment:
| Q |
1 |
tctgcaatcatgtattgaatattatttaattgaaatcagaactt |
44 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5042718 |
tctgcaatcatgtattgaatattgtttaattgaaatcagaactt |
5042675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University