View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_25 (Length: 279)
Name: NF8109_low_25
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 48557521 - 48557653
Alignment:
| Q |
1 |
acggagggatcgtagcatgccaaatcaatttagaccaggttttattattgatgcaatgcaataatgttgctgttgtgtaaccaaataggatagattggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
48557521 |
acggagggatcgtagcatgccaaatcaatttagaccaggttttattattgatgcaatgcaataatgttacagttgtgtaaccaaataggatagattggac |
48557620 |
T |
 |
| Q |
101 |
catcttcttttgagacaatgatgaaatacactt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48557621 |
catcttcttttgagacaatgatgaaatacactt |
48557653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 168 - 262
Target Start/End: Original strand, 48557646 - 48557740
Alignment:
| Q |
168 |
atacactttatgatatactacactttatgaatcgggcttaattacaaagcactaattcacataatccactttgagcatctgcaatggaggtcctt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
48557646 |
atacactttatgatatactacactttatgaatcgggcttaattacaaagcactaattcacataacccacttggagcatctgcaatgaaggtcctt |
48557740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University