View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_28 (Length: 254)
Name: NF8109_low_28
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 254
Target Start/End: Original strand, 1699032 - 1699265
Alignment:
| Q |
21 |
gggaaaagataggcttactttctttctaacattctctgtaataatatttacttacttttttattgggtaaaatatatgtgagtcttacactattttatat |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| || ||| ||||| ||||||||||||||||||| | |
|
|
| T |
1699032 |
gggaaaagataggcttactctctttctaacattctctgtaataatacttacttacttttttattgagtgaaacatatgcgagtcttacactattttatgt |
1699131 |
T |
 |
| Q |
121 |
gtgattcatttttaaagtgtgaaatccactttattttaattcaataaaagagtgaatgttagagagacttttgaaaggagattgtcaataacactcatct |
220 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
1699132 |
gtgattcattttcaaagtgtgaaattcactttattttaattcaataaaagagtgaatgttagagagacttttggaaggagattgtcaataacactcgtca |
1699231 |
T |
 |
| Q |
221 |
attgtcgaatgatttgtaatatcttttttctttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1699232 |
attgtcgaatgatttgtaatatcttttttctttt |
1699265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University