View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_32 (Length: 244)
Name: NF8109_low_32
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 25899359 - 25899151
Alignment:
| Q |
18 |
cagagacggtgaaaatgtacacaagaaaagttaaataatttcaaacacaacatgaatcttaattgatcggaagggaattaaggtttgtgtttgattattt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25899359 |
cagagacggtgaaaatgtacacaataaaagttaaataatttcaaacacaacatgaatcttaattgatcggaagggaattaaggtttgtgtttgattattt |
25899260 |
T |
|
| Q |
118 |
ttagcagatctaaaagattaagaaaatgagaaagagaacatttgtattttcaagaattcgattgaaccttaccattttagaacggggagggggtttaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
25899259 |
ttagcagatctaaaagattaagaaaatgaaaaagagaacatttgtattttcaagaatttgatcgaaccttatcattttgaaacgggga-ggggtttaaag |
25899161 |
T |
|
| Q |
218 |
atcaagtggt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
25899160 |
atcaagtggt |
25899151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University