View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_33 (Length: 242)
Name: NF8109_low_33
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 24656055 - 24656120
Alignment:
| Q |
1 |
cattaacgattaaaccctcaatttagatcactcttctatctagtctttaaacaataaacacacaat |
66 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24656055 |
cattaacgagtaaaccctcaatttagatcactcttctatctagtctttaaacaatgaacacacaat |
24656120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 29415280 - 29415210
Alignment:
| Q |
1 |
cattaacgattaaaccctcaatttagatcactcttctatctagtc-tttaaacaataaacacacaatgttt |
70 |
Q |
| |
|
||||||||| ||||||||||||||||| | ||||| | ||||||| |||||| ||| |||||||||||||| |
|
|
| T |
29415280 |
cattaacgagtaaaccctcaatttagacccctcttttgtctagtcttttaaataatgaacacacaatgttt |
29415210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 179
Target Start/End: Original strand, 13992461 - 13992499
Alignment:
| Q |
141 |
tacaacttgtatttaaatactaccgttcaggttacaata |
179 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
13992461 |
tacaacttgtgtttaaatactaccgttcagtttacaata |
13992499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University