View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_34 (Length: 240)
Name: NF8109_low_34
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 36158022 - 36157798
Alignment:
| Q |
1 |
ttgagctcgaatatttatcttcgtatttatgtgannnnnnnn-attgtttttctttatatgagatgatgtttgcattaatttggaaggctctactgataa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36158022 |
ttgagctcgaatatttatcttcgtatttatgtgaattttttttattgtttttctttatatgagatgatgtttgcattaatttggaaggctctaccgataa |
36157923 |
T |
 |
| Q |
100 |
acatcacaagtgcctactatgctaaaatcatagaagaattataagcatattacatcttttagcatttgttatagcttaaatttcttgttgatattgcagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36157922 |
acatcacaagtgcctactatgctaaaatcatagaagaattataagcatattacatcttttagcatttgttatagcttaaatttcttgttgatattgcagc |
36157823 |
T |
 |
| Q |
200 |
attggtgctgagtatatgaggattg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36157822 |
attggtgctgagtatatgaggattg |
36157798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 51 - 220
Target Start/End: Complemental strand, 36153033 - 36152866
Alignment:
| Q |
51 |
tctttatatgagatgatgtttgcattaatttggaaggctctactgataaacatcacaagtgcctactatgctaaaatcatagaagaattataagcatatt |
150 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||| ||||||||| | |
|
|
| T |
36153033 |
tctttatataatatgatgtttgcattgatttggaaggctctactgataaa-attacaagtgcctactatgctaaaatcataggagaat-ataagcatagt |
36152936 |
T |
 |
| Q |
151 |
acatcttttagcatttgttatagcttaaatttcttgttgatattgcagcattggtgctgagtatatgagg |
220 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
36152935 |
atatcgtttagcatttgttatagcttaaatttctacttgatattgcagcattggtgctgagcatatgagg |
36152866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University