View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_39 (Length: 236)
Name: NF8109_low_39
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 219
Target Start/End: Original strand, 1355147 - 1355358
Alignment:
| Q |
8 |
gagtgagatgaatggaaccatttctgaataaattcttccacaacatataccttaagatgaaatcagatgataaagttagcaactattgcatgtttgacag |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1355147 |
gagtgacatcaatggaaccatttctgaataaattcttccacaacatataccttaagatgaaatcagatgataaagttagcaactattgcatgtttgacag |
1355246 |
T |
 |
| Q |
108 |
tcaactactgacttcttttacatcttctctttatgttgctggttttgttacttccttctttgcttcttatgtcaccagagtctttggtcgcaagccatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1355247 |
tcaactactgacttcttttacatcttctctttatgttgctggttttgttacttccttctttgcttcttatgtcaccagagtctttggtcgcaagccatct |
1355346 |
T |
 |
| Q |
208 |
atcgttgcaggt |
219 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1355347 |
atcgttgcaggt |
1355358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University