View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8109_low_43 (Length: 228)
Name: NF8109_low_43
Description: NF8109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8109_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 26425790 - 26425580
Alignment:
| Q |
16 |
cttataaaaatttgtcca-ccctaaatcatatggctcatgtgattatattacattccttgtgacacaatccgtgacaatagccaagtagaaaatgaggan |
114 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26425790 |
cttataaaaatttgtccatccctaaatcatatggctcatgtgattatattacattccttgtgacacaatccgtgacaatagccaagtagaaaatgagga- |
26425692 |
T |
 |
| Q |
115 |
nnnnnnnnnnnnnnnnnnnnacggttaaatgaggaatagtttttgttaattgtattattggtgtaatatatccacccattttgttgatgactaacttctg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
26425691 |
-tttttttttcttattttttacggttaaatgaggaatagtttttgttaattgtattattggtgtaatatatccactcattttgttgatgacttacttctg |
26425593 |
T |
 |
| Q |
215 |
ttgggtattattt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26425592 |
ttgggtattattt |
26425580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 137 - 224
Target Start/End: Complemental strand, 26424365 - 26424279
Alignment:
| Q |
137 |
ggttaaatgaggaatagtttttgttaattgtattattggtgtaatatatccacccattttgttgatgactaacttctgttgggtatta |
224 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||| | || ||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
26424365 |
ggttaaatgaggaataatttttgttgatcgtattattggcg-aagatatccacccattttgttgatgactaacttctgctaggtatta |
26424279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University