View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8110_high_5 (Length: 241)
Name: NF8110_high_5
Description: NF8110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8110_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 31168438 - 31168312
Alignment:
| Q |
1 |
atctttatgatttttatcatgtttcataaaatgtacaaaaataaacacacctagttgctgccataaccatgtgcttgaatttcttttttggctcagtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31168438 |
atctttatgatttttatcatgtttcataaaatgtacaaaaataaacacacctagttgctgccataaccatgtgcttgaatttcttttttggctcagtgtc |
31168339 |
T |
 |
| Q |
101 |
agagctcaagacctgcaatgtgataat |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31168338 |
agagctcaagacctgcaatgtgataat |
31168312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 31168269 - 31168231
Alignment:
| Q |
185 |
ttatcctaaaatacctgacttatcaataaatcaccaagg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31168269 |
ttatcctaaaatacctgacttatcaataaatcaccaagg |
31168231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 38629430 - 38629479
Alignment:
| Q |
45 |
acacacctagttgctgccataaccatgtgcttgaatttcttttttggctc |
94 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| || |||||||| ||||| |
|
|
| T |
38629430 |
acacacctagtagctgccataactatgtgctttaacttctttttaggctc |
38629479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University