View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8110_low_10 (Length: 235)
Name: NF8110_low_10
Description: NF8110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8110_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 41405796 - 41406009
Alignment:
| Q |
8 |
tggacatcaacaaaaagtcaagaatgtttgcgtgtaaattatgaatttggctgatatattaatattattattagattgagatgtcatgaggattaaaata |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41405796 |
tggacatgaacaaaaagtcaagaatgtttgcgtgtaaattaagaatttggctgatatactaatattattattagattgagatgtcatgaggattaaaata |
41405895 |
T |
 |
| Q |
108 |
ggctatgaaggttttgagtgaataaattgatgtgtacacatccaggacttgttcattgtgtcatttaaacttgtgttatcatacttgtcaacttggtgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41405896 |
ggctatgaaggttttgagtgaataaattgatgtgtacacatccaggacttgttcattgtgtcatttaaacctgtgttatcatacttgtcaacttggtgat |
41405995 |
T |
 |
| Q |
208 |
tttgtaatactatt |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41405996 |
tttgtaatactatt |
41406009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University