View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8110_low_7 (Length: 252)
Name: NF8110_low_7
Description: NF8110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8110_low_7 |
 | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 103 - 237
Target Start/End: Complemental strand, 25000207 - 25000073
Alignment:
| Q |
103 |
tcttggatcgggtagtaacttcatagccttggagcatgtcaaaaaatgatgatgcaattaatccgaccaacaaggtactagaatttgttgatcgaacctg |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
25000207 |
tcttggatcgggtaataacttcatagccttggagcatgtcaaaaaatgatgatgcaattaatccgaccaacaaggtactagaatttgctgatggaacctg |
25000108 |
T |
|
| Q |
203 |
tcaaaaaatatgcggacgacttggatatgaaacat |
237 |
Q |
| |
|
|||||| ||||| ||||||||| | ||||||||| |
|
|
| T |
25000107 |
tcaaaagttatgcagacgacttgaacatgaaacat |
25000073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 552895 - 552847
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaaca |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
552895 |
attttctgcataacttagcagaccggttctctctagattatcaccaaca |
552847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 16413685 - 16413637
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaaca |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| | ||||||||||| |
|
|
| T |
16413685 |
attttctgcataacttagcagacctgttccctctaaaatatcaccaaca |
16413637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17531852 - 17531804
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaaca |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17531852 |
attttctgcataacttagcagaccggttctctctagaatatcaccaaca |
17531804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17536261 - 17536213
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaaca |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17536261 |
attttctgcataacttagcagaccggttctctctagaatatcaccaaca |
17536213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 26617686 - 26617736
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaacagt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
26617686 |
attttctgcataacttagcagaccgattctctctagaatatcaccaacagt |
26617736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 26723614 - 26723664
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaacagt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
26723614 |
attttctgcataacttagcagaccgattctctctagaatatcaccaacagt |
26723664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 38705 - 38657
Alignment:
| Q |
1 |
attttctgcataacttagcagaccagttctctctagattatcaccaaca |
49 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
38705 |
attttctgcataacttagcagaccaattgcctctagaatatcaccaaca |
38657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 22752 - 22705
Alignment:
| Q |
2 |
ttttctgcataacttagcagaccagttctctctagattatcaccaaca |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||| |||||| |
|
|
| T |
22752 |
ttttctgcataacttagcagaccaattccctctagaatatcgccaaca |
22705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University