View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_high_1 (Length: 325)
Name: NF8111_high_1
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 156 - 307
Target Start/End: Complemental strand, 491863 - 491715
Alignment:
| Q |
156 |
tatacatcatcaacctttcccgtttctcactcattatctggaattcctccctcgacctctcttacttttgcggtgacctagacgagcttcttggagaaat |
255 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
491863 |
tatacatcatcaaccgttcccgtttctcactcattatctggaattcctccctcgacctctcttactttcgcggtgacctagacgagcttcttggagaaat |
491764 |
T |
 |
| Q |
256 |
ctctagttgttttccacttaaaatcacgtcactcaatcttggagagcttctt |
307 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
491763 |
ctcta---gttttccacttaaaatcacgtcactcaatcttggagagcttctt |
491715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 26 - 70
Target Start/End: Complemental strand, 491987 - 491943
Alignment:
| Q |
26 |
agagcatgtcaaagattcttataatgcaatgaaggaatgaatgtt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
491987 |
agagcatgtcaaagattcttataatgcaatgaaggaatgtatgtt |
491943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University