View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_high_4 (Length: 267)
Name: NF8111_high_4
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 11613201 - 11613431
Alignment:
| Q |
20 |
aattatttaaatttactaccattttctacaagattaaattaccaacttggttcacaggatgaaatttcataaactgtatcatcaaccaacacatcttgct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613201 |
aattatttaaatttactaccattttctacaagattaaattaccaacttggttcactggatgaaatttcataaactgtatcatcaaccaacacatcttgct |
11613300 |
T |
|
| Q |
120 |
ccaagcattgagaaataacctagtttccttaaaaaggtttgtgtcttgagtattagcaatggaaaaaatagaagtgaaggggtacatatcccttatatag |
219 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613301 |
ccaagcattgaga---aaactagtttccttaaaaaggtttgtgtcttgagtattagcaatggaaaaaatagaagtgaaggggtacatatcccttatatag |
11613397 |
T |
|
| Q |
220 |
gtttactcaaatcgactttacgcgcttatagtat |
253 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
11613398 |
gtttactcaaatcgactttccgcgcttatagtat |
11613431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University