View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_high_7 (Length: 241)
Name: NF8111_high_7
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45280159 - 45279895
Alignment:
| Q |
1 |
cttggaagtatataaaatgatcattatgaaaaataaaccaaaatgatcagtatgaacttttactcttactgtta----attaacctttgtttt------- |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45280159 |
cttggaagtatataaaatgatcattatgaaaaataaaccaaaatgatcagtatgaacttttactcttactgttaattaattaacctttgttttatgttaa |
45280060 |
T |
 |
| Q |
90 |
-------------gttgcaaacataaatttatgtacaagaatacttatatatctattttcaatttcagtctctctcaaatagtgttgaagacaaggcgaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280059 |
tgcgaattgttttgttgcaaacataaatttatgtacaagaatacttatatatctattttcaatttcagtctctctcaaatagtgttgaagacaaggcgaa |
45279960 |
T |
 |
| Q |
177 |
acttttcatcaacaagctcaaaggtacttgctatttttataacatatttgcagtttgagaataat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45279959 |
acttttcatcaacaagctcaaaggtacttgctatttttataacatatttgcagtttgagaataat |
45279895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University