View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_low_15 (Length: 315)
Name: NF8111_low_15
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 135 - 280
Target Start/End: Original strand, 47523178 - 47523322
Alignment:
| Q |
135 |
catacattacattttttgcgagagataatgatgtatcaactgtttagttctagctatatggtttgctagtgaattatgtaaagaattgagtttttgttga |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523178 |
catacattacattttttgcgagagataatgatgtatcaactgtttagttctagctatatggtt-gctagtgaattatgtaaagaattgagtttttgttga |
47523276 |
T |
|
| Q |
235 |
tgttgtcgtcgtcgtcgacttgatttatgattgaattggcgtgtga |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523277 |
tgttgtcgtcgtcgtcgacttgatttatgattgaattggcgtgtga |
47523322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 47523059 - 47523120
Alignment:
| Q |
17 |
atatttaagtgtaatggagaagattt-agatttgagtttacaatgtttgaaattatgggtga |
77 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523059 |
atatttaagtgtaatggagaagattttagatttgagtttacaatgtttgaaattatgggtga |
47523120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University