View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_low_19 (Length: 264)
Name: NF8111_low_19
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 247
Target Start/End: Complemental strand, 2484356 - 2484125
Alignment:
| Q |
16 |
acatcacatattttcttatatttttgtctctttttcacttgtttaacctagctgttgaccaatatatattaggtcatggttgcttgcacatggagtccct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484356 |
acatcacatattttcttatatttttgtctctttttcacttgtttaacctagctgttgaccaatatatattaggtcatggttgcttgcacatggagtccct |
2484257 |
T |
|
| Q |
116 |
aagatctctcactttgtctttgtagatgatattatgttgcttttggttatgatatataacacttcatggaattgcttcactttttgaaattcatcatggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2484256 |
aagatctctcactttgtctttgtagatgatattatgttgcttttggttatgatatataacacttcatgcaattgcttcactttttgaaattcatcatggt |
2484157 |
T |
|
| Q |
216 |
ttgatcaagcattatggcttaattggaagggt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2484156 |
ttgatcaagcattatggcttaattggaagggt |
2484125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 149 - 244
Target Start/End: Original strand, 30455183 - 30455276
Alignment:
| Q |
149 |
atgttgcttttggttatgatatataacacttcatggaattgcttcactttttgaaattcatcatggtttgatcaagcattatggcttaattggaag |
244 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30455183 |
atgttgctattggttatgatata--acacctcatggaattgcttcactttttgaaattcattatggtttgatcaagcattatggcttaattggaag |
30455276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 36053392 - 36053453
Alignment:
| Q |
180 |
catggaattgcttcactttttgaaattcatcatggtttgatcaagcattatggcttaattgg |
241 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
36053392 |
catggaattgcttcactttttaaaactcatcatggttttatcaagcattgtggcttaattgg |
36053453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University