View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_low_21 (Length: 257)
Name: NF8111_low_21
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_low_21 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 45521617 - 45521378
Alignment:
| Q |
18 |
aacctttgtgtgttaacatcaccccttttggtagacctgttgttcctgatgaatatggcagcgcaacaacatcgtctggatggatctttgcatcaggaag |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45521617 |
aacctttgtgtgttaacataaccccttttggtagacctgttgttcctgatgaatatggcagcgcaacaacatcgtctggctggatctttgcatcaggaag |
45521518 |
T |
|
| Q |
118 |
atgatcattctcatctgcttcttggatgatcagcgttgagaaatggacatgatcattgttattatcatctatggaagagtctaccaacacaaccttatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521517 |
atgatcattctcatctgcttcttggatgatcagcgttgagaaatggacatgatcattgttattatcatctatggaagagtctaccaacacaaccttatga |
45521418 |
T |
|
| Q |
218 |
tcattgttgttcaacaaatctttgactttgtcatagtaac |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521417 |
tcattgttgttcaacaaatctttgactttgtcatagtaac |
45521378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 350617 - 350547
Alignment:
| Q |
20 |
cctttgtgtgttaacatcaccccttttggtagacctgttgttcctgatgaatatggcagcgcaacaacatc |
90 |
Q |
| |
|
||||||||||||| ||| || ||||| |||||||| |||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
350617 |
cctttgtgtgttagcataacacctttaggtagaccggttgttccagatgaatatggcaatgcaaccacatc |
350547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University