View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8111_low_9 (Length: 352)
Name: NF8111_low_9
Description: NF8111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8111_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 28 - 336
Target Start/End: Original strand, 7108807 - 7109115
Alignment:
| Q |
28 |
cagagaatatgagtttaaaatgacctctatccaattacaaatgttttcattaaaaccaaaagctttcaaaatcttcaaaagaaattttcattccacagtg |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108807 |
cagacaatatgagtttaaaatgacctctatccaattccaaatgttttcattaaaaccaaaagctttcaaaatcttcaaaagaaattttcattccacagtg |
7108906 |
T |
 |
| Q |
128 |
tcaaaagctttataaatgtctattttaagggcaagattacctccaaaagatctattatggagaagatcggttgcctctcaagtgaggttgatacactctt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
7108907 |
tcaaaagctttataaatgtctattttaagggcaagattacctccaaaagatctattatggcgaagatcgggtgcctctcaagtgaggttgatgcactctt |
7109006 |
T |
 |
| Q |
228 |
tgatttgtctttgttgaataaatcctctttgatgattagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaa |
327 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7109007 |
tgatttgtctgtgttgaataaattctctttgctgcttagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaa |
7109106 |
T |
 |
| Q |
328 |
cttgaagtt |
336 |
Q |
| |
|
||||||||| |
|
|
| T |
7109107 |
cttgaagtt |
7109115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University