View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8112_low_3 (Length: 214)
Name: NF8112_low_3
Description: NF8112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8112_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 98 - 200
Target Start/End: Complemental strand, 27940742 - 27940640
Alignment:
| Q |
98 |
tagaaaaaat-ctaaagtgacaataaaaatcgaacagagggagtaagaagttgcgggtttgaactagcacccaacttatcaatgttatttcaagagttat |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27940742 |
tagaaaaaatgctaaagtgacaataaaaatcgaag-gagggagtaagaagttgcgggtttgaactagcacccaacatatcaatgttatttcaagagttat |
27940644 |
T |
 |
| Q |
197 |
attt |
200 |
Q |
| |
|
|||| |
|
|
| T |
27940643 |
attt |
27940640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 96
Target Start/End: Complemental strand, 27940933 - 27940891
Alignment:
| Q |
54 |
aacaactatactaaatattctaaaatgacaaatagtttgagac |
96 |
Q |
| |
|
|||||||||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
27940933 |
aacaactatactaaatattctaaagtggcaattagtttgagac |
27940891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University