View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8113_low_13 (Length: 241)
Name: NF8113_low_13
Description: NF8113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8113_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 39263906 - 39263694
Alignment:
| Q |
12 |
ttttgggttggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagctaacccatggttgaaaatcatagcatgcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39263906 |
ttttgggttggaagaggcatagctatgggattgaattttggtgattgtaatttgatttcatagtcatagcttacccatggttgaaaatcatagcatgcaa |
39263807 |
T |
|
| Q |
112 |
accgtctctgagataaactgtgcagatcaattgttgtgaggtgtaaaatgaatatatcaaactatcacgtgcaatgcgaagctgaaggaaacatgcacac |
211 |
Q |
| |
|
|| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39263806 |
actgtctccgagataaactgtgccgatcaattgttgtgaggtgtaaaatgaatatatcaaactatcacgtgcaatgcgaagctgaaggaaacatgcacac |
39263707 |
T |
|
| Q |
212 |
ctgagttgtatat |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39263706 |
ctgagttgtatat |
39263694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 42773454 - 42773392
Alignment:
| Q |
20 |
tggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagct |
82 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
42773454 |
tggatgaggcatagctatgggattgaattttggtgtttgtaattagatttcagagtcatagct |
42773392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 53747744 - 53747682
Alignment:
| Q |
20 |
tggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagct |
82 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||| ||||| |||| |
|
|
| T |
53747744 |
tggatgaggcatagctatgggattgaattttggtgtttgtaattagatttcagagtcacagct |
53747682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 14185121 - 14185059
Alignment:
| Q |
20 |
tggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagct |
82 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| || |||||||| | || |||||||||| |
|
|
| T |
14185121 |
tggatgaggcatagcaatgggattgaattttggtgtttctaattagattccagagtcatagct |
14185059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 54
Target Start/End: Original strand, 21977768 - 21977796
Alignment:
| Q |
26 |
aggcatagctatgggattgaattttggtg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21977768 |
aggcatagctatgggattgaattttggtg |
21977796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University